Strolen\s Citadel content. 
30 Underused Character Classes
NPCs  (Character Sheet)   (Travelers)
Cheka Man's comment on 2017-09-11 11:55 PM
Almost finished. 5/5 Go to Comment
30 Underused Character Classes
NPCs  (Character Sheet)   (Travelers)
Cheka Man's comment on 2017-09-15 10:09 AM
It says

The Submission can be HoH'd in 0 days.

but it is not letting me give it an HOH vote. Go to Comment
30 Underused Character Classes
NPCs  (Character Sheet)   (Travelers)
axlerowes's comment on 2017-10-07 02:22 PM
this a fun primer, should be added to most notebooks
Go to Comment
30 Underused Character Classes
NPCs  (Character Sheet)   (Travelers)
valadaar's comment on 2017-09-07 10:50 PM
A nice set of character concepts! Lots of ideas here... Go to Comment
Lightning Elemental
Lifeforms  (Ethereal)   (Any)
Scrasamax's comment on 2017-09-05 04:04 PM
Update: Meh Go to Comment
Lightning Elemental
Lifeforms  (Ethereal)   (Any)
Dragonlordmax's comment on 2017-09-08 08:27 PM
Perhaps a bit more of a system-generic stat-block than an idea to build up into something else, but there's still some need for those.

Personally, I might have liked some plot hooks or something. I do kind of like the visual of living thunderstorms battling on the horizon. Go to Comment
Lightning Elemental
Lifeforms  (Ethereal)   (Any)
axlerowes's comment on 2017-09-05 09:16 PM
Why not? I could have used this in my shadowrun-esque campaigns years ago with very little additions. Go to Comment
IronCorps
Society/ Organizations  (Combative)   (Trans World)
Cheka Man's comment on 2017-08-28 12:42 AM
Only voted Go to Comment
IronCorps
Society/ Organizations  (Combative)   (Trans World)
axlerowes's comment on 2017-11-02 06:32 PM
The hook had me on this one, I thought neat an organization of sauve body guards that put equal emphasis onf style and substance. But then it just turns into another list of fantasy equipment without stats.


The writing: it is like I am just reading the footnotes for piece. I get writing footnotes, but why not give us the whole thing. It is also a little two Scras-styled for my tastes, lots of proper nouns, no characters, no personality: a narrativeless fact explosion without personality written in the voice of an expert not burdened by doubt or academic sensibilities.


ACTCTAGAGTCGACCTGCAGGCATGCAAGC Go to Comment
The Adventuring Orders
Society/ Organizations  (Combative)   (Regional)
Cheka Man's comment on 2017-08-28 12:44 AM
Well worth reading. Go to Comment
ElectraCorp and Tetropolis
Society/ Organizations  (Technical)   (Trans World)
Aramax's comment on 2017-09-02 12:06 PM
4.5/5 While awesome and FULL of potential for adventuring(In fact this would make an
amazing adventure modual that would work well for a supers game too) I feel that you missed the boat a little bit on this. This is perfect to turn into a DF and expand the CEs Cthuhu conection. Don't squander the oppertunity!!!! Go to Comment
Project Infinity
Plots  (Hired)   (Campaign)
Cheka Man's comment on 2017-08-26 09:42 PM
Only voted Go to Comment
The Bikini Situation
Lifeforms  (Unique)   (Water)
Cheka Man's comment on 2017-08-21 08:37 PM
A true danger to all around it. Go to Comment
The Bikini Situation
Lifeforms  (Unique)   (Water)
axlerowes's comment on 2017-09-05 09:39 PM
This is fun idea, I like the idea of the giant semi-intelligent hive being. I like how you went into detail of the types of weapons, and the idea of the white admiral is nice touch. It would be fun to write up some wargame scenarios for the cosmic era. How much work would it be to pull together some basic rules for movement and damage and then start drawing up some units. We could do the Amerkia Command Infantry units, Pacific Rim flight mechs, a couple parapyschic command units, that could be neat.


As to the writing:

I suggest changing the opening sentence. If this was a work of non-fiction it would be described as "fact explosion'. As it is a work of fiction you need to add just enough specific details to offer versimilitude but enough to be dull and estoric.

"it's something of an old sailor's tale from the Pacific, most of the time the only people who know these stories are the the Hakka PROPER NOUN, Tanka PROPER NOUN, and Hoklo boat people of Southeast Asia PROPER NOUN, mercenaries and subvsersives of the Python Patrol PROPER NOUN, and the fleet intelligence communities of the Eurasian Alliance (Submarine Fleet) PROPER NOUN PacRim Coalition (Micronesia Fleet Arm) PROPER NOUN, and the Atlantic Federation (Space Intelligence) PROPER NOUN."

If this was a work non-fiction this would be what is called a 'fact explosion'. All these names are numbing and become meaningless. Plus you don't reference back to them in a meaningful way. Go to Comment
The Bikini Situation
Lifeforms  (Unique)   (Water)
Aramax's comment on 2017-08-31 11:05 AM
5/5JPN J ust P lain N ice!!!!!!!!!!! Go to Comment
The Bikini Situation
Lifeforms  (Unique)   (Water)
Aramax's comment on 2017-12-04 02:05 PM
I have adapted this to fantasy , using the basic Idea of "Moby Dick" and the creature known as "The Pirate Fleet" looking forward to game 2 Go to Comment
EMS
Systems  (Ecological)   (Specific)
Scrasamax's comment on 2017-08-20 09:02 AM
Seeing as parapsy abilities are rooted in spiritual trauma, it could lead that the presence of EMS and its symptoms could aggravate the situation. The people in the towers are cleaner, more insulated, and more complacent, while the people in the sprawl and undercity are being irradiated as well oppressed. That works nicely. Go to Comment
EMS
Systems  (Ecological)   (Specific)
Cheka Man's comment on 2017-08-06 11:16 AM
Only voted Go to Comment
EMS
Systems  (Ecological)   (Specific)
valadaar's comment on 2017-08-19 10:11 PM
Hmm, perhaps EMS could trigger the occurrence of mutations and psionic powers as well. Powers that be might speed up their containment if they learned this fact - or perhaps not...

Go to Comment
Infinity Class
Items  (SpaceShips)   (Campaign Defining)
Scrasamax's comment on 2017-08-20 09:03 AM
There is more to Project Infinity, I just need more computer time to get it out. The Charlatan tag is there for a reason Go to Comment
Total Comments:
8612

Join Now!!



       By: Strolen

The PC's enter a town amid a giant celebration, the Spring Wedding Festival. Unmarried men and women from all over the provinces gather her every spring to be matched by the most sacred matchmaker ever to live, Holly Lovard. Holly is now ancient and must be carried everywhere she visits and rumors are that this will be her last visit to the Wedding Festival so any matches made this spring will be doubley blessed.
Enter PC's, wrong place at the wrong time. Molly sees one of them, calls him/her out of the crowd and that are unable to resist the push and pull of the mob. Brought in front of Molly Lovard, the PC is declared the lifemate of .
Could be the king's daughter, a peasant, member of the thieves guild. Could be anything to add a twist to an already building plot, or just throw the characters into an awkward situation.

Encounter  ( City/ Ruin ) | February 16, 2003 | View | UpVote 2xp