Strolen\s Citadel content. 
The Plain of Taranis
Locations  (Area)   (Plains)
Scrasamax's comment on 2017-09-15 07:07 PM
I'd like to get back to just writing some stuff without stringing together elaborate backstories and settings. Go to Comment
The Plain of Taranis
Locations  (Area)   (Plains)
Cheka Man's comment on 2017-09-14 11:36 PM
A very dangerous place to be. Go to Comment
The Plain of Taranis
Locations  (Area)   (Plains)
Murometz's comment on 2017-09-29 04:32 PM
Yesss, this is the stuff!! (That I miss reading) What axle and Val said. Go to Comment
The Plain of Taranis
Locations  (Area)   (Plains)
axlerowes's comment on 2017-09-15 05:36 PM

Damn this is good, classic retro feel, good visuals. In some ways I want more, but on the other hand there is something to be said for the concise use of GM voice and the piece's overall brevity.

Go to Comment
The Plain of Taranis
Locations  (Area)   (Plains)
valadaar's comment on 2017-09-19 10:39 AM
Love this. Brings back memories. More of this please :) Go to Comment
30 Underused Character Classes
NPCs  (Character Sheet)   (Travelers)
Cheka Man's comment on 2017-09-11 11:55 PM
Almost finished. 5/5 Go to Comment
30 Underused Character Classes
NPCs  (Character Sheet)   (Travelers)
Cheka Man's comment on 2017-09-15 10:09 AM
It says

The Submission can be HoH'd in 0 days.

but it is not letting me give it an HOH vote. Go to Comment
30 Underused Character Classes
NPCs  (Character Sheet)   (Travelers)
axlerowes's comment on 2017-10-07 02:22 PM
this a fun primer, should be added to most notebooks
Go to Comment
30 Underused Character Classes
NPCs  (Character Sheet)   (Travelers)
valadaar's comment on 2017-09-07 10:50 PM
A nice set of character concepts! Lots of ideas here... Go to Comment
Lightning Elemental
Lifeforms  (Ethereal)   (Any)
Scrasamax's comment on 2017-09-05 04:04 PM
Update: Meh Go to Comment
Lightning Elemental
Lifeforms  (Ethereal)   (Any)
Dragonlordmax's comment on 2017-09-08 08:27 PM
Perhaps a bit more of a system-generic stat-block than an idea to build up into something else, but there's still some need for those.

Personally, I might have liked some plot hooks or something. I do kind of like the visual of living thunderstorms battling on the horizon. Go to Comment
Lightning Elemental
Lifeforms  (Ethereal)   (Any)
axlerowes's comment on 2017-09-05 09:16 PM
Why not? I could have used this in my shadowrun-esque campaigns years ago with very little additions. Go to Comment
IronCorps
Society/ Organizations  (Combative)   (Trans World)
Cheka Man's comment on 2017-08-28 12:42 AM
Only voted Go to Comment
IronCorps
Society/ Organizations  (Combative)   (Trans World)
axlerowes's comment on 2017-11-02 06:32 PM
The hook had me on this one, I thought neat an organization of sauve body guards that put equal emphasis onf style and substance. But then it just turns into another list of fantasy equipment without stats.


The writing: it is like I am just reading the footnotes for piece. I get writing footnotes, but why not give us the whole thing. It is also a little two Scras-styled for my tastes, lots of proper nouns, no characters, no personality: a narrativeless fact explosion without personality written in the voice of an expert not burdened by doubt or academic sensibilities.


ACTCTAGAGTCGACCTGCAGGCATGCAAGC Go to Comment
The Adventuring Orders
Society/ Organizations  (Combative)   (Regional)
Cheka Man's comment on 2017-08-28 12:44 AM
Well worth reading. Go to Comment
ElectraCorp and Tetropolis
Society/ Organizations  (Technical)   (Trans World)
Aramax's comment on 2017-09-02 12:06 PM
4.5/5 While awesome and FULL of potential for adventuring(In fact this would make an
amazing adventure modual that would work well for a supers game too) I feel that you missed the boat a little bit on this. This is perfect to turn into a DF and expand the CEs Cthuhu conection. Don't squander the oppertunity!!!! Go to Comment
Project Infinity
Plots  (Hired)   (Campaign)
Cheka Man's comment on 2017-08-26 09:42 PM
Only voted Go to Comment
The Bikini Situation
Lifeforms  (Unique)   (Water)
Cheka Man's comment on 2017-08-21 08:37 PM
A true danger to all around it. Go to Comment
The Bikini Situation
Lifeforms  (Unique)   (Water)
axlerowes's comment on 2017-09-05 09:39 PM
This is fun idea, I like the idea of the giant semi-intelligent hive being. I like how you went into detail of the types of weapons, and the idea of the white admiral is nice touch. It would be fun to write up some wargame scenarios for the cosmic era. How much work would it be to pull together some basic rules for movement and damage and then start drawing up some units. We could do the Amerkia Command Infantry units, Pacific Rim flight mechs, a couple parapyschic command units, that could be neat.


As to the writing:

I suggest changing the opening sentence. If this was a work of non-fiction it would be described as "fact explosion'. As it is a work of fiction you need to add just enough specific details to offer versimilitude but enough to be dull and estoric.

"it's something of an old sailor's tale from the Pacific, most of the time the only people who know these stories are the the Hakka PROPER NOUN, Tanka PROPER NOUN, and Hoklo boat people of Southeast Asia PROPER NOUN, mercenaries and subvsersives of the Python Patrol PROPER NOUN, and the fleet intelligence communities of the Eurasian Alliance (Submarine Fleet) PROPER NOUN PacRim Coalition (Micronesia Fleet Arm) PROPER NOUN, and the Atlantic Federation (Space Intelligence) PROPER NOUN."

If this was a work non-fiction this would be what is called a 'fact explosion'. All these names are numbing and become meaningless. Plus you don't reference back to them in a meaningful way. Go to Comment
The Bikini Situation
Lifeforms  (Unique)   (Water)
Aramax's comment on 2017-08-31 11:05 AM
5/5JPN J ust P lain N ice!!!!!!!!!!! Go to Comment
Total Comments:
8595

Join Now!!



       By: Scrasamax

A pair of ladies lace gloves, that once donned, give the wearer a quick, and very tidy manicure. Nails are properly trimmed, sanded, and come out with either 'French' (insert game name) style nails, or their nails colored in the manner desired by the wearer. Useful for removing hangnails, and other cosmetic problems

Ideas  ( Items ) | August 7, 2004 | View | UpVote 0xp