Strolen\s Citadel content. 
Broadhead Defensive Drone
Items  (Ranged Weapons)   (Combat)
axlerowes's comment on 2017-10-07 03:49 PM
Nice, I like the details, I found the opening paragraph and little confusing and wasn't sure how all the parts fit together. Go to Comment
Projector Drone
Items  (Home/ Personal)   (Non-Magical)
axlerowes's comment on 2017-10-07 03:46 PM
Not to be too gaming minded, but this a great write up for addition to a game world, you got stats, it is useful itean and an item that encourages player creativeity. I really like it.

Cooper and Jade though? Couldn't they use plastics or ceramics and keep the production costs down? ;) Go to Comment
ZAP!Stop!
Items  (Other)   (Villanous)
axlerowes's comment on 2017-10-07 03:42 PM
I like the voice and the detail, you did a very good job of describing a rather complex physical arrangment of objects.

On a side not, how do you go about mixing physics and modern scientific knowledge into your games? Would accept such things as lights that produce now heat, could you sufficate fire elementals by depriving them of oxygen, and do your fantasy characters even know what oxygen is?

Go to Comment
30 Underused Character Classes
NPCs  (Character Sheet)   (Travelers)
axlerowes's comment on 2017-10-07 02:22 PM
this a fun primer, should be added to most notebooks
Go to Comment
Lightning Elemental
Lifeforms  (Ethereal)   (Any)
axlerowes's comment on 2017-09-05 09:16 PM
Why not? I could have used this in my shadowrun-esque campaigns years ago with very little additions. Go to Comment
Nartine the Stubborn, Avatar of Mathom
NPCs  (Minor)   (Mystical)
axlerowes's comment on 2017-10-07 02:19 PM
this is funny, i like it, she'd be fun to introduce into a storyline, and inventive protagonists could find a way to use her as a problem solving tool. Go to Comment
IronCorps
Society/ Organizations  (Combative)   (Trans World)
axlerowes's comment on 2017-11-02 06:32 PM
The hook had me on this one, I thought neat an organization of sauve body guards that put equal emphasis onf style and substance. But then it just turns into another list of fantasy equipment without stats.


The writing: it is like I am just reading the footnotes for piece. I get writing footnotes, but why not give us the whole thing. It is also a little two Scras-styled for my tastes, lots of proper nouns, no characters, no personality: a narrativeless fact explosion without personality written in the voice of an expert not burdened by doubt or academic sensibilities.


ACTCTAGAGTCGACCTGCAGGCATGCAAGC Go to Comment
The Bikini Situation
Lifeforms  (Unique)   (Water)
axlerowes's comment on 2017-09-05 09:39 PM
This is fun idea, I like the idea of the giant semi-intelligent hive being. I like how you went into detail of the types of weapons, and the idea of the white admiral is nice touch. It would be fun to write up some wargame scenarios for the cosmic era. How much work would it be to pull together some basic rules for movement and damage and then start drawing up some units. We could do the Amerkia Command Infantry units, Pacific Rim flight mechs, a couple parapyschic command units, that could be neat.


As to the writing:

I suggest changing the opening sentence. If this was a work of non-fiction it would be described as "fact explosion'. As it is a work of fiction you need to add just enough specific details to offer versimilitude but enough to be dull and estoric.

"it's something of an old sailor's tale from the Pacific, most of the time the only people who know these stories are the the Hakka PROPER NOUN, Tanka PROPER NOUN, and Hoklo boat people of Southeast Asia PROPER NOUN, mercenaries and subvsersives of the Python Patrol PROPER NOUN, and the fleet intelligence communities of the Eurasian Alliance (Submarine Fleet) PROPER NOUN PacRim Coalition (Micronesia Fleet Arm) PROPER NOUN, and the Atlantic Federation (Space Intelligence) PROPER NOUN."

If this was a work non-fiction this would be what is called a 'fact explosion'. All these names are numbing and become meaningless. Plus you don't reference back to them in a meaningful way. Go to Comment
Wolf Knights of Falkwrath
Society/ Organizations  (Combative)   (Regional)
axlerowes's comment on 2017-09-05 09:20 PM
wish I'd thought of this years ago. Go to Comment
30 More Kings
NPCs  (Scenario Based)   (Political)
axlerowes's comment on 2017-07-18 11:02 PM
I take it you're not Irish. Go to Comment
7 Things About Fate of the Furious
Articles  (Humor/ Editorial)   (Gaming - Genre)
axlerowes's comment on 2017-04-23 01:23 PM
Only voted Go to Comment
7 Things About The Fast and the Furious
Articles  (Humor/ Editorial)   (Gaming - In General)
axlerowes's comment on 2017-04-14 12:06 PM
Only voted Go to Comment
7 Things About Beauty and the Beast
Articles  (Humor/ Editorial)   (Gaming - In General)
axlerowes's comment on 2017-04-14 12:07 PM
Only voted Go to Comment
JOSH-Annex 1
Locations  (Fortification)   (Space)
axlerowes's comment on 2017-03-29 07:36 PM
Good one, what does it look like when you're driving west toward Denver on a clear day? Go to Comment
30 Arcology Modules
Items  (Home/ Personal)   (Campaign Defining)
axlerowes's comment on 2017-03-29 07:45 PM
This is a good and useful resource for understanding the cosmic era life in the arcos, I liked the part about the maintence worker mafias, the new focus on mental health and the bromance stuff.

How long can you leave your kid in the daycare?

The classified bay...kind of felt tacked on and underdeveloped. You don't have to stop at 30. Go to Comment
Agonizer
Items  (Jewelry)   (Villanous)
Agonizer
Items  (Jewelry)   (Villanous)
axlerowes's comment on 2017-03-08 09:48 PM
Why would any of the Machiavellian rulers in the Pacific Rim or the Atlantic Confederation think twice about installing these in all the plebs? Who are these moral voices judging things as barbaric? Go to Comment
Agonizer
Items  (Jewelry)   (Villanous)
axlerowes's comment on 2017-03-09 07:26 AM
You didn't answer the question at all. you went on to some tangent on the USA's moral failings. In your response you have argued, and I accept, that it is possible to have a regime that is on one hand morally and socially progressive and then brutally oppressive with the other hand. But that is not what i asked. I asked why?

I could attempt to explain the sources of contradiction in modern western social policy, but that may not be directly applicable to this fictional setting you have been pontificating on for ten years. And I wonder why, without an involved populace, elections, nepotism, spiritual or philosophical institutions, or a free consumer based economy why the ATfed or PRR would be the moral torchbears?

On another level how does having these moral institutions or sensibilities fit into your storytelling? Do you need social definitions of human rights thrown into the cosmic era?

But again, I only give as much of shit about this as much as you do. So if you are fine with it, cool, but if you want to play back-and-forth with this setting I am here.
so lets try again,
What are the social and economic forces that push the Atlantic federation to be the torch bears of western civilization?

Go to Comment
Agonizer
Items  (Jewelry)   (Villanous)
axlerowes's comment on 2017-03-10 06:29 AM

that would be a sub worth talking about, but what if we extrapolate from Cheka's idea a bit. As has been pointed before, one of the big differences being a man and a women is that if you are a woman roughly half the population can overpower you and/or kill you with their bare hands. This is not a speculative concern, more than that woman (on a worldwide population level) have been beaten and murdered by their intimate partners consistently throughout recorded human history (with many such events going unrecorded). Did the choir get all that?

Back to the agonizer, so what if your well-meaning social justice warriors decided that the agonizer was the solution to this problem, a way to level the playing field. When a couple forms a commited relationship or an intimate relationship starts (monogamous coupling rarely survives the vision of futurists, Scras is no different) what if instead of rings or keys they exchange agonizer codes. Or perhaps only men get agonizers implants. The agonizer gets implemented with the best of intentions.

Go to Comment
Order of Ixium
Society/ Organizations  (Criminal/Espionage)   (Trans World)
axlerowes's comment on 2017-04-10 08:12 AM
I read this a couple of days ago on my phone. This are very specific piece of meta-fiction. I think this narrative would make an interesting backstory for a character or NPC. A former member of the Order of Ixium could have a quite the history under that restructured personality and the physical mask. The association with the Order would also provide such a character with air of tragedy, hubris and violence.

The write up is a little inaccessible. Take the first sentence "The Order of Ixium was founded by the House of the Forsaken Lord Demandred" There is very little inform in that sentence, which in itself is okay if we later learned to what all those proper nouns were referring. We never get definitions for the "House of the Forsaken" and Lord Demandred and since that is how you start the definition the order of Ixium, we never truly get a definition of them either. We can make assumptions, Lord Demandred sounds like a skinny imperious fellow in a high necked collar and cape, and House of the Forsaken sounds like a bunch of supervillain wannabes. But I suggest either explicit definitions or a longer piece from which we could extract more information from context. Go to Comment
Total Comments:
2022

Join Now!!



       By: Michael Jotne Slayer

In the harbour of a major city a large and terrifying ship made of human nails docks. Nobody seems to inhabit this ominous vessel, someone needs to go on board and unveil the mystery. In comes the PCs.

Encounter  ( Water ) | February 15, 2011 | View | UpVote 6xp