Strolen\s Citadel content. 
Dream Well
Items  (Unique)   (Any)
axlerowes's comment on 2017-10-07 05:32 PM
neat, check out Scras's 100 world challenges.
Go to Comment
30 Questions to ask your players
Articles  (Character)   (Players)
axlerowes's comment on 2017-11-02 06:42 PM
I always did the same thing, slightly different list, but was part of my Gamemasting since I bought the shadowrun manual when I was 15
Go to Comment
30 Questions to ask your players
Articles  (Character)   (Players)
axlerowes's comment on 2017-11-02 06:42 PM

1) Appearance, posture attitude presence.

2) Response to people (what kind of interaction or relationship does the character prefer to have with people) and how does this effect the above topic?

3) What does your character admire in other people?

4) Does your character possess these qualities?

5) How does your character want to present himself to others and what is your character default view of others?

1) What are your characters strengths of personality?

2) What are your character weaknesses?

3) Does your character feel like a completed person?

4) Do you forsee or wish to explore any major changes in the character’s personality?

5) What is your characters primary ambition or vision of him or herself in the future? What is your ambition for this character?.

1) Who have been the major influences in your character’s life?

2) Who does your character love?

3) Who does your character hate?

4) What does your character enjoy?

5) What does you character detest?

1) How does the character feel about violence?

2) What is the character afraid of?

3) What is your characters opinion of other forms of life?

4) What is your character opinion about killing?

5) How will your character react when confronted with his or her own death, does your character know they will react that way and what contributes to that reaction.

What is your character alignment?

What is your character’s name?

Go to Comment
Metody
NPCs  (Minor)   (Technical)
axlerowes's comment on 2017-11-02 06:35 PM
Sweet and concise, I like the format as well Go to Comment
Neon Bunny
NPCs  (Minor)   (Technical)
axlerowes's comment on 2017-11-02 06:38 PM
again nice format, I'd like to see you explore this character in a narrative, see where she takes you. Go to Comment
The Plain of Taranis
Locations  (Area)   (Plains)
axlerowes's comment on 2017-09-15 05:36 PM

Damn this is good, classic retro feel, good visuals. In some ways I want more, but on the other hand there is something to be said for the concise use of GM voice and the piece's overall brevity.

Go to Comment
30 Types of Fire
Articles  (Setting Building)   (Gaming - In General)
axlerowes's comment on 2017-10-07 04:15 PM
There are some neat ones in here, I suprised by some of the invitivness on the list.

Sometimes I can't tell if you are trying to use a consistent voice. For example, the entry for Dragon Fire suggests that this whole list is written with a limited in world knowledge. You described Block Fire as overpowered, which could be read as a meta-level description of the spell, plus you mention city blocks which seems a little anachronistic. These bumps might not be so awkward if the voice was made clearer. Go to Comment
Broadhead Defensive Drone
Items  (Ranged Weapons)   (Combat)
axlerowes's comment on 2017-10-07 03:49 PM
Nice, I like the details, I found the opening paragraph and little confusing and wasn't sure how all the parts fit together. Go to Comment
Projector Drone
Items  (Home/ Personal)   (Non-Magical)
axlerowes's comment on 2017-10-07 03:46 PM
Not to be too gaming minded, but this a great write up for addition to a game world, you got stats, it is useful itean and an item that encourages player creativeity. I really like it.

Cooper and Jade though? Couldn't they use plastics or ceramics and keep the production costs down? ;) Go to Comment
ZAP!Stop!
Items  (Other)   (Villanous)
axlerowes's comment on 2017-10-07 03:42 PM
I like the voice and the detail, you did a very good job of describing a rather complex physical arrangment of objects.

On a side not, how do you go about mixing physics and modern scientific knowledge into your games? Would accept such things as lights that produce now heat, could you sufficate fire elementals by depriving them of oxygen, and do your fantasy characters even know what oxygen is?

Go to Comment
30 Underused Character Classes
NPCs  (Character Sheet)   (Travelers)
axlerowes's comment on 2017-10-07 02:22 PM
this a fun primer, should be added to most notebooks
Go to Comment
Lightning Elemental
Lifeforms  (Ethereal)   (Any)
axlerowes's comment on 2017-09-05 09:16 PM
Why not? I could have used this in my shadowrun-esque campaigns years ago with very little additions. Go to Comment
Nartine the Stubborn, Avatar of Mathom
NPCs  (Minor)   (Mystical)
axlerowes's comment on 2017-10-07 02:19 PM
this is funny, i like it, she'd be fun to introduce into a storyline, and inventive protagonists could find a way to use her as a problem solving tool. Go to Comment
IronCorps
Society/ Organizations  (Combative)   (Trans World)
axlerowes's comment on 2017-11-02 06:32 PM
The hook had me on this one, I thought neat an organization of sauve body guards that put equal emphasis onf style and substance. But then it just turns into another list of fantasy equipment without stats.


The writing: it is like I am just reading the footnotes for piece. I get writing footnotes, but why not give us the whole thing. It is also a little two Scras-styled for my tastes, lots of proper nouns, no characters, no personality: a narrativeless fact explosion without personality written in the voice of an expert not burdened by doubt or academic sensibilities.


ACTCTAGAGTCGACCTGCAGGCATGCAAGC Go to Comment
The Bikini Situation
Lifeforms  (Unique)   (Water)
axlerowes's comment on 2017-09-05 09:39 PM
This is fun idea, I like the idea of the giant semi-intelligent hive being. I like how you went into detail of the types of weapons, and the idea of the white admiral is nice touch. It would be fun to write up some wargame scenarios for the cosmic era. How much work would it be to pull together some basic rules for movement and damage and then start drawing up some units. We could do the Amerkia Command Infantry units, Pacific Rim flight mechs, a couple parapyschic command units, that could be neat.


As to the writing:

I suggest changing the opening sentence. If this was a work of non-fiction it would be described as "fact explosion'. As it is a work of fiction you need to add just enough specific details to offer versimilitude but enough to be dull and estoric.

"it's something of an old sailor's tale from the Pacific, most of the time the only people who know these stories are the the Hakka PROPER NOUN, Tanka PROPER NOUN, and Hoklo boat people of Southeast Asia PROPER NOUN, mercenaries and subvsersives of the Python Patrol PROPER NOUN, and the fleet intelligence communities of the Eurasian Alliance (Submarine Fleet) PROPER NOUN PacRim Coalition (Micronesia Fleet Arm) PROPER NOUN, and the Atlantic Federation (Space Intelligence) PROPER NOUN."

If this was a work non-fiction this would be what is called a 'fact explosion'. All these names are numbing and become meaningless. Plus you don't reference back to them in a meaningful way. Go to Comment
Wolf Knights of Falkwrath
Society/ Organizations  (Combative)   (Regional)
axlerowes's comment on 2017-09-05 09:20 PM
wish I'd thought of this years ago. Go to Comment
30 More Kings
NPCs  (Scenario Based)   (Political)
axlerowes's comment on 2017-07-18 11:02 PM
I take it you're not Irish. Go to Comment
7 Things About Fate of the Furious
Articles  (Humor/ Editorial)   (Gaming - Genre)
axlerowes's comment on 2017-04-23 01:23 PM
Only voted Go to Comment
7 Things About The Fast and the Furious
Articles  (Humor/ Editorial)   (Gaming - In General)
axlerowes's comment on 2017-04-14 12:06 PM
Only voted Go to Comment
7 Things About Beauty and the Beast
Articles  (Humor/ Editorial)   (Gaming - In General)
axlerowes's comment on 2017-04-14 12:07 PM
Only voted Go to Comment
Total Comments:
1981

Join Now!!



       By: MoonHunter

If you want to add a "supernatural" touch to your campaign, define the rules of magic and the universe. Make your players comfortable with those rules. Then your new supernatural creatures must then break those rules.

Ideas  ( System ) | July 23, 2005 | View | UpVote 2xp